0
What else can I help you with?
Continue Learning about Natural Sciences
Related Questions
How many 1.43 cm is equal to how many mm?
1 cm = 10 mm so 1.43 cm = 14.3 mm
How many 2.4 cm is mm?
2.4 cm = 24 mm 1 cm - 10 mm
How many mm are there in 1.2 cm?
1 cm = 10 mm 1.2 cm = 12 mm
How many mm rounds to how many cm?
1 cm = 10 mm.
How many mm equals to 15 cm?
1 cm = 10 mm 2 cm = 20 mm . . 10 cm = 100 mm . . 15 cm = 150 mm
How many mm equals to 30 cm?
1 cm = 10 mm 2 cm = 20 mm . . . 9 cm = 90 mm 10 cm = 100 mm 20 cm = 200 mm 30 cm = 300 mm
How many mm is there to a cm?
10 mm = 1 cm
How many mm or in a cm?
1 cm = 10 mm
How many mm are there in cm?
A cm is 10 mm.
How many mm are in the cm?
10 mm = 1 cm
How many mm in 31 cm?
1 cm = 10 mm Therefore 3.1 cm = 31 mm
How many centimeters are in 3500 mm?
10 mm = 1 cm 100 mm = 10 cm 1,000 mm = 100 cm 3,000 mm = 300 cm 3,500 mm = 350 cm
Trending Questions
What time in the US will the December 31st 2009 lunar eclipse start?
Will propel make plants grow?
How many boxes can fit in a 7feetx7feetx8feet cube?
If you have 45L of helium in a balloon at temperature of25c and increased the temperature of the balloon to 55c what will the new volume of the balloon be?
Is oxygen element monoatomic or diatomic?
Why do plants only need a small amount of magnesium for growth?
What happens to propane when it is all burnt?
What is the definition of herbal energy?
What are two or substances that have been combined but not chemically changed?
Would a can of coke freeze on Neptune?
What is the temperatures of stars from hottest to coldest?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Does increasing a chain length make it stronger or weaker?
When a common fluorescent lamp is on the mercury vapor inside is actually in a which state?
How do you make a model of a sea urchin?
What is magnitude in regor?
Which macromolecule is in malt syrup?
What pumps blood in earthworms?
Can bacteria in the body change its form into a different bacteria?
If the north American plate moves at an average rate of 3 cm per year what distance has it moved over the last 50 million years?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.