Tags Math and Arithmetic Units of Measure Weight and Mass

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Science>Natural Sciences

How many kilograms is 800 pounds?

Updated: 5/26/2024

Wiki User

∙ 14y ago

Best Answer

mass and weight are not the same...

mass is how much "stuff" is an object (matter)

weight is the force exerted on object due to gravity, the unit pounds is a measurement of weight not mass but grams/kg measure mass

Wiki User

∙ 14y ago

This answer is:

More answers

Wiki User

∙ 14y ago

Answer: 800 kg = 1763.698 lb

OR 1763 lb and 11.16 oz

This answer is:

AnswerBot

∙ 5mo ago

800 pounds is approximately 363 kilograms.

This answer is:

Add your answer:

Earn +20 pts

Q: How many kilograms is 800 pounds?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Natural Sciences

How do you convert 800 Kilograms to lbs?

To convert kilograms to pounds, you multiply the number of kilograms by 2.20462. Therefore, 800 kilograms is approximately 1763.73 pounds.

What is 800 pounds?

800 pounds is a measurement of weight equivalent to approximately 363 kilograms.

What is 800 kilogram?

800 kilograms is a unit of mass equivalent to 1763.70 pounds or roughly 0.8 metric tons.

How many pounds are in 2000 kilograms?

2,000 pounds = 907.18474 kilograms.

How many pounds in three kilograms?

There are approximately 6.61 pounds in three kilograms.

Related questions

How many kilograms are 800 pounds?

800 lbs = 362.9 kg

What is 800 lbs in kilograms?

800 pounds = 362.87 kilograms.

How do you convert 800 Kilograms to lbs?

To convert kilograms to pounds, you multiply the number of kilograms by 2.20462. Therefore, 800 kilograms is approximately 1763.73 pounds.

How many kilograms are in 800 pounds?

It is equal to 362 kilograms approximately. Kilogram is the metric unit and pound is the imperial unit for mass. 1 Kilogram is 2.204 pounds. So we multiply pound by 0.4535 to get the equivalent kilograms.

What is 800 pounds?

800 pounds is a measurement of weight equivalent to approximately 363 kilograms.

What does 800 Lb gorille means in Metric Terms?

800 pounds equates to 362.874kg (kilograms).

What is 800 kilogram?

800 kilograms is a unit of mass equivalent to 1763.70 pounds or roughly 0.8 metric tons.

How many pounds are in 2000 kilograms?

2,000 pounds = 907.18474 kilograms.

If 3 ml per kg what would 800 pounds be?

To determine the total volume of fluid needed for an 800-pound person at a rate of 3 ml per kg, you first convert pounds to kilograms. Since 1 kg is approximately 2.2 pounds, you would divide 800 by 2.2 to get the weight in kilograms. Then, multiply the weight in kilograms by 3 ml to find the total volume needed.

How many pounds is 204 kilograms?

203 kilograms = 447.54 pounds.

How many kilograms are in 111 pounds?

There are 50.349 kilograms in 111 pounds.

How many pounds in 11.0 kilograms?

There are about 50 kilograms in 110 pounds.

Trending Questions

Is a finless porpoise a carnivore a herbivore an omnivore or a decomposer? How would the excretion of metabolic waste from cells be related to the concept of surface area to volume ratio? How is a radar and a telescope similar? How did the invetion change through the years? Can you use barriers to stop lava flow? What are 2 ways that a leaf help a plant survive? How many planets are in our soler sestym? What are some complications of hemodialysis? What three things does blood composition depend on? How does weather change? When connecting single-pole 3-way and 4-way switches they must be wired so that all switching is done in the circuit conductor.? What does hydrogenation of fat mean? Is it true Dentin anchors the tooth in place? Questions which there is only one answer such as What are the obstacles to manned missions to Mars are unsuitable as the basis of a research essay? How many grams of oxygen are required to complete combustion of 2.75 moles of propane? Is barium synthetic? Which type of rna makes up the ribsomes? What forms on re-acidification of the solution? Do homeostatic mechanisms act through positive feedback? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?

Previously Viewed

How many kilograms is 800 pounds?

Unanswered Questions

What is erectile dysfunction (ED), and what treatments are available? How do you measure weight with a load cell? What are 5 tips for financial success in your 20s? How many sides do 4 pentagons and 5 decagons have in all? What ingredients are typically used in Mixture Namkeen? Is Mixture Namkeen spicy, and are there different flavor options? What are the popular ways to enjoy Mixture Namkeen? What are the most common mistakes people make when hiring cleaners for their homes or offices?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.