0
What else can I help you with?
Continue Learning about Natural Sciences
For medication how many ML is in 2 oz?
1oz = 30ml 2oz = 60ml 1 tablespoonful = 15ml 60ml = 4 tablespoonfuls or 12 teaspoonfuls
How many ml are in a double whisky?
A standard double whisky pour is typically 60ml, which is equivalent to 2 oz.
11 oz plus 3 lb equals how many oz?
59oz 1lb =16 oz btw
11oz plus 3lb equals how many oz?
11 oz plus 3lb will be equal to 59 oz.
11 lb 8 oz equals how many oz?
11 lb 8 oz is equal to 184 oz.
Related Questions
How many milliliters in whiskey double?
60ml
How many ounzes is 60ml?
if fluid oz then 60/28.35 = 2.116
For medication how many ML is in 2 oz?
1oz = 30ml 2oz = 60ml 1 tablespoonful = 15ml 60ml = 4 tablespoonfuls or 12 teaspoonfuls
How much is 60ml of water?
60 ml = 2 oz
How many 20 ml are in 60ml?
There are 3 units of 20ml in 60ml, because 20ml x 3 = 60ml.
How many ounces in 4ml water?
4 US fluid ounces = 118.29 ml
How many ml are in a double whisky?
A standard double whisky pour is typically 60ml, which is equivalent to 2 oz.
How many liters does 60mL equal to?
0.06
How many ml are in 12 peaspoons?
60ml
How many mL does 0.06L equal?
60ml
How many grams does 60ml of cream equal?
60-70 depending on the percentage.
What is 25 of 300ml?
it is 60ml
Trending Questions
What time in the US will the December 31st 2009 lunar eclipse start?
Will propel make plants grow?
How many boxes can fit in a 7feetx7feetx8feet cube?
If you have 45L of helium in a balloon at temperature of25c and increased the temperature of the balloon to 55c what will the new volume of the balloon be?
Is oxygen element monoatomic or diatomic?
Why do plants only need a small amount of magnesium for growth?
What happens to propane when it is all burnt?
What is the definition of herbal energy?
What are two or substances that have been combined but not chemically changed?
Would a can of coke freeze on Neptune?
What is the temperatures of stars from hottest to coldest?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Does increasing a chain length make it stronger or weaker?
When a common fluorescent lamp is on the mercury vapor inside is actually in a which state?
How do you make a model of a sea urchin?
What is magnitude in regor?
Which macromolecule is in malt syrup?
What pumps blood in earthworms?
Can bacteria in the body change its form into a different bacteria?
If the north American plate moves at an average rate of 3 cm per year what distance has it moved over the last 50 million years?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.