answersLogoWhite

0

Subjects>Science>Natural Sciences

How many quarts in 36 ounces?

User Avatar

Anonymous

∙ 11y ago
Updated: 6/3/2024

1152 US fluid ounces

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Continue Learning about Natural Sciences

How many quarts equal 36 ounces?

1.125 quarts.


How many quarts in 180 ounces?

120 fluid ounces is 3.75 quarts.


How many quarts are in 72 ounces?

62 fluid ounces is 1.94 quarts.


How many quarts are in 400 ounces?

There are 12.5 quarts in 400 ounces.


How many ounces is in 3.3 quarts?

There are approximately 105.6 ounces in 3.3 quarts.

Related Questions

How many quarts equal 36 ounces?

1.125 quarts.


How many quarts does 36 ounces make?

1.125 quarts.


How many quarts in 180 ounces?

120 fluid ounces is 3.75 quarts.


How many quarts are in 72 ounces?

62 fluid ounces is 1.94 quarts.


How many quarts are in 400 ounces?

There are 12.5 quarts in 400 ounces.


How many ounces equal how many quarts?

4 quarts of water is 128 ounces.


14 ounces how many quarts?

0.4375 quarts.


How many ounces are in 44 quarts?

1.375 quarts.


How many ounces is three quarts?

Three quarts = 96 ounces.


How many ounces is in 3.3 quarts?

There are approximately 105.6 ounces in 3.3 quarts.


14 ounces equals how many quarts?

0.4735 quarts.


75 ounces equals how many quarts?

2.344 quarts.

Trending Questions
Do ginger contain reducing sugar in food test? What is the meaning for the weathering tonight will be dominated by air movement that is causedby air moving from areas of high to low pressure? Is KCI a symbol or formula? What process is similar to photosynthesis? What can happen when a glacier melts in a cirque? Who thought of plate tectonics theory? Why do plants cell have an additional layer surrounding The cell membrane? Where would iron and copper be on the periodic table? What is to obliterate the pleural space means? What is the zero degree latitude line called? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you wire a 3-wire 240V 15A pump motor to a GFCI receptacle or GFCI breaker? Why do adipose cells appear empty? What properties of marble make it useful for carving statues? How is the delta H fusion used to calculate the energy needed to melt a mass of solid? Does a catabolic reaction absorb or require energy? Are volcanoes evenly distributed or concentrated in zones? Is pursues an abstract noun? Are clovers invasive species? Which cell organelle is responsible for powering the cell?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.