Tags Biggest, Strongest, Fastest and Other Extremes

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Science>Natural Sciences

What is Bayliner the world's largest manufacturer of?

Updated: 11/3/2022

Wiki User

∙ 11y ago

Best Answer

Bayliner is the world's largest manufacturer of recreational boats. Bayliner was established in 1957 and has 400 dealers in 60 countries worldwide at the moment.

Wiki User

∙ 11y ago

This answer is:

Add your answer:

Earn +20 pts

Q: What is Bayliner the world's largest manufacturer of?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Natural Sciences

What is the worlds largest ecozone?

Palearctic

What is Delaware's largest chemical manufacturer?

dupont

Where is the Worlds Largest Things Incorporated in Lucas Kansas located?

The address of the Worlds Largest Things Incorporated is: Po Box 101, Lucas, KS 67648-0101

What is the worlds largest praire?

Popsicle ridge just go with the answer

What holds the record for the worlds largest ice sculpture?

The record for the worlds largest ice sculpture is held by Yichin City, China. Many people took part in making the record.

Related questions

Who is the worlds largest golf club manufacturer?

Top Flite is the worlds largest golf club manufacturer.

Who is the worlds largest car manufacturer?

Gm and Honda

What is the worlds largest shotgun manufacturer in the world?

mossberg

Who is the worlds largest alcohol manufacturer?

Anheuser Busch-InBev

Who was the Worlds largest car manufacturer by the end of the 1920s?

Ford

What was the worlds largest automobile manufacturer by the 1920's?

FORD

Who is the largest tire manufacturer?

Other than Legos, the worlds largest tire manufacture is Goodyear.

Home of the worlds largest manufacturer of magic supplies?

Colon, MI

Which is the worlds first largest optical storage media manufacturer?

Ritek Corporation

Which company is posting a stiff competition to Sweden's Ericson to become a worlds largest Telecom equipment manufacturer?

Huawai

The worlds largest animal?

Worlds largest animal: Blue Whale

Where is the Worlds largest rail network?

USA has the worlds largest rail network.

Trending Questions

How should you describe a comet? What macro-molecule is in yogurt? A group of organasms working togethor to do a specific job in the body is a? Is an avocado a gymnosperm or a angiossperms? What is 60 degrees north longitude 110 degrees east latitude? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? Is helium a hydrocarbon? What can affect a population after it reaches the carrying capacity? What unit do I use to measure a picture frame? Is brown hair prettier than blonde? What kind of pulses did Venus' topography has been mapped from space and earth? You saw a picture of a very hot girl and under the picture it said she was a GG what does GG mean? Is the ozone dead? How many moles of potassium oxide (K2O) will be formed when 1.52 moles of potassium reacts with oxygen according to the following reaction 4 K O2 2 K2O? Why do bodies of water trend to moderate temperature swings from day to day? What is the population of Blackland Prairie Texas? Do most religions favor or oppose organ and tissue donation? Does a potato plant have flowers? What is special about the structure of growth hormone? Is it true that the pH of a solution remains constant with increasing basicity?

Previously Viewed

What is Bayliner the world's largest manufacturer of?

Unanswered Questions

How long does it take to recover from cosmetic dental procedures? What is a Micro DC, and what is its purpose? How do you clean grout on marble tile floors without damaging the marble? How can I protect my marble surfaces from etching? How could I book the best New Year package in Nainital? What is a suffix for remote? What ingredients are used in Mixture, and is it spicy? Can I order Mixture in bulk for parties or events?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.