answersLogoWhite

0

How many is 17 over 400?

User Avatar

Anonymous

∙ 7y ago
Updated: 10/17/2024

As a percentage... 4.25 percent.

User Avatar

Wiki User

∙ 7y ago
Copy

What else can I help you with?

Related Questions

What what divided by what equals 17 over 20?

many things 85/100 =17/20 for example so does 170/200 and 340/400


What is 17 percent of 400?

17% of 400= 17% * 400= 0.17 * 400= 68


How many times can 17 go into 400?

16


How many times 400 go into 7000?

To determine how many times 400 goes into 7000, you would perform the division 7000 ÷ 400. The quotient is 17.5, which means that 400 goes into 7000 17 times with a remainder of 300. This is calculated by dividing 7000 by 400, resulting in a quotient of 17 and a remainder of 300.


How many paintings did Frida Kahlo paint?

she sold over 400


How many mountains are there in Argentina?

over 400


Is 17 over 20 equivalent to 20 over 24?

No, they are unequal, multiply the denominators by each other you should get 480. multiply 17 by 24 to get 408/480 (408 over 480) multiply 20 by 20 to get 400/480 (400 over 480) I multiplied 17 over 20 by 24 and 20 over 24 by 20 to see if they would be equal values this is a trick you can try to check if any fractions are equal.


How many pelicans are left in the wild?

over 400


How many gods do egyptians believe in?

over 400


How many skyscrapers are there in Denver?

about 300


How many players were in the MLS in 2001?

Over 400


How many players were in the MLS in 2002?

Over 400

Trending Questions
Does trunks have kids? Who created the IRS? Can Windex clear up acne? What is the union carpenter scale in North Dakota? Is an authorized user of a credit card responsible for the debt after the account holder dies intestate without assets if all cash advances and purchases were made only for the holder's benefit? How do you change the thermostat on a 2000 VW Passat? Where have all prehistoric paintings been found? What is ball ammunition? Who is jack tar? Why did northern and southern states argue over new states that entered the us? Who gave birth to the devil? Why are contrast and chiaroscuro an? What is the complementary sequence for atgcccgggtgtcgtagttga? What was REM's most famous song? What did Abigail do in act 4? How big can a domestic turkey grow? What ended slavery? Can you get adulticide and microfilaricide to treat heartworms in your dog yourself? What is lilys favorite color in The Secret Life of Bees? How do i plug in a dodge diesel truck?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.