0
What else can I help you with?
Related Questions
How many yards in two tenth of a kilometer?
2/10 of a kilometer = 218.723 yards.
How many metres in a half kilometer?
There are 500 meters in a half kilometer; a kilometer is 1,000 meters.
How many meters are there in one tenth of a kilometer?
300 metres
How many feet is half a kilometer?
A half-kilometer is 1640.42 feet
How many milliliters are there in half a kilometer?
In half a kilometer, there is 500,000 millimeaters
How many meters in a half a kilometer?
There are 500 meters in a half kilometer (0.5) (1,000 meters = 1 kilometer)
How many meters there in one tenth of a kilometers?
One tenth (1/10) of a kilometer (1,000 meters) is equal to 100 meters.
How many meters are in are in one - half a kilometer?
Half a kilometre = 500 metres
How many meters in 1 tenth of a kilometer?
The conversion relations between km and m are given .By the conversion table :1km =1000 m.1/10 km =100 m.Hence , there are 100m in 1 tenth of a kilometer.
What is half of a kilometer?
Half a kilometer is 500 meters.
How many one half a kilometer?
500 meters
Round 1.89 square kilometer to the nearest tenth of a square kilometer?
1.90
Trending Questions
Can musk turtles live with red eared sliders?
What is 59kilos in stones and pounds?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
What is the computer game RC Laser Warrior?
Explain how manifest destiny influenced the westward exoansion of the united states in the 1800s?
What are the release dates for Behind the Headlights - 2004 James Dean?
How does climate affect the outcome of history?
What does it mean when water is condensed?
What is the orgin of handkerchief head?
Will anybody give me free players or coins on fifa 13 ultimate team?
Who is the individual responsible for all incident activities including the developement of strategies and tactics and the ordering and release of resources?
How old do you have to be to buy a scope?
When did Rabindranath Tagore write kingdom of cards?
What title is given to eldest son of british throne?
Continental crust are?
What was the goal of macon's bill 2?
What changes have occured in daintree rainforest?
Who was Gerald Nye?
Are Prince Philip and Queen Elizabeth related?
What causes slow hair growth in the armpit?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.