0
What else can I help you with?
Continue Learning about Natural Sciences
Ho much is 33.8 fl oz plus 16.9 fl oz?
33.8 fl oz + 16.9 fl oz = 50.7 fl oz.
How much liters is 15 oz of water?
15 US fl oz = 0.444L
How much more is 1 lb 4 oz and 11 oz?
Based on the assumption that the question should read, "How much more is 1 lb 4 oz than 11 oz ?" 1 lb = 16 oz therefore 1 lb 4oz = 16 + 4 = 20 oz. 20 - 11 = 9. 1 lb 4oz therefore weighs 9 oz more than 11 oz.
How much is 0.1 oz in pounds?
45.359237 grams
How much is 84 oz of water coverted to milliliters?
84 oz of water is approximately equal to 2,494 milliliters.
Related Questions
How much is 33Cl in milliliter?
33 cl--->330 ml cl x 10---->ml
How many calories is a regular 33cl Heineken?
110 in 25cl bottle. 33cl 110/25*33=145 cal
How many calories in a can of Bavaria 0.0?
78 per 33cl Can
How many Calories in sol beer?
125 Cals in a 33cl bottle
What is 33 g in milliliters?
33cL is equal to 330mL @10mL per centilitre.
how much an oz?
how much an oz
How much is 0.42 oz of an oz?
.42 oz...
How much oz are in a lb and oz?
17 oz
how much per oz?
how much is silver per oz?
How much is in a oz?
there are 170g in 6 oz
How much in oz it 1kg?
35.27 oz.
How much is 195g as oz?
6.87842 oz
Trending Questions
What is the name of that place were 6month day and 6month night?
What was an accomplishment in aristarchus life?
What does the process part of the technological system do?
What molecule is split to release oxygen?
What is the word for the process that changes minerals into new minerals?
What are examples of conyloid joints?
What sense does your vestibular organ give you?
What are the measure of the strength of an earthquake is called?
What if fluorine's atomic number?
How many moles of Na SO4 are in 25.0 of this compound?
Why was the flow rate for shale so much lower than for the sandstone?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
How many amps is a 500 watt power inverter?
Use rubbing alcohol to disinfect laundry?
Where are the Mississippi River head waters?
Four pounds of a gas occupies 10 ft3 WHAT would be its total volume density and specific gravity?
What is the factors that can affect an individuals views on death and dying?
Is fungi adapted for living on land?
Speed measured in units is called what?
A lamp is to be controlled independently by switches in two different locations?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.