answersLogoWhite

0

What is 70-120?

User Avatar

Anonymous

∙ 14y ago
Updated: 10/17/2024

190

User Avatar

Queenie Botsford ∙

Lvl 10
∙ 4y ago
Copy

What else can I help you with?

Related Questions

How can four players play at the same time on the ps2 for Madden 07?

For more than two players to play Madden NFL 07 simultaneously on the Sony PlayStation 2, a Multitap is required. It has the Sony item number 70120. Insert the Multitap into controller port 1 and insert the four controllers into the Multitap. Now all four people can participate in multiplayer mode.


What is the number telephone of the miz?

john samson phne 239651704 john samon wwe the miz job security john samson


Trending Questions
WHAT CLOTHES SHOULD YOU BRING FOR JUPITER? Is the lead singer in 3oh3 a Christian? Do birds on a telephone line wire indicate the coming of rain? Is the lead singer of Avenged Sevenfold Jewish? Where can you play mugen match 9? Who were the next door neighbors on the TV series Maude? Did Ice Cream flavored chewing gum ever exist? How many cats can you feed if you get three fourths of cat food and sixteen and one half of cat food? What is the LCM of 5and6and8? Who gives a persuasive speech at Caesar's funeral? What is the greatest common factor of 14 35 and 63? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? When was Edward Lawry Norton born? Whose court was birbal a minister in? Calibration of compass 1996 Dodge Ram 1500? Is mothball smell harmful to babies? Can you exercise while having an IUD? Is the white guy dead that played roach in next friday? Who was attila the hun's mother? Does nitrogen have a positive or negative charge?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.