0
What else can I help you with?
Related Questions
What are is the greatest common factor of 28 42 and 63?
The Greatest Common Factor of 28, 42, 63: 7
Greatest common factor of 42 and 28?
Greatest common factor of 42 and 28 is 14.
What is the greatest common factor of28and42and what the answer?
The greatest common factor of the numbers 28 and 42 is 14.
What is the greatest common factor for 28 and 42?
7
What is the greatest common factor for 28 42 and 63?
The GCF is 7.
What are all the common factors of 42 and 28 and state the greatest common factor?
Factors of 28... 1,2,4,7,14,28 Factors of 42... 1,2,3,6,7,14,21,42 GCF = 14
What is the GCF of the numbers 28 and 42?
The Greatest Common Factor (GCF) of 42 and 28 is 14.
What is Greatest Common Factor of 14 28 and 42?
gcf(14, 28, 42) = 14.
What is the Greatest common factor of 28 56 42?
The Greatest common factor is 14.
What are the greatest common factor of 28 and 42?
The GCF is 14.
What is the greatest common factor of the numbers 28 42?
The greatest common factor of 28 and 42 is 7
What two numbers have the greatest common factor of fourteen?
Two numbers that have the greatest common factor of 14 are 28 and 42.
Trending Questions
How do you write 7.5 in word form?
Why does my cat like sweet things?
What is 33 percent of 255?
How do you trade Pokemon to emerald from coliseum?
When a magnet is suspended in freely still air then which direction the north pole will rest?
Do monkeys have short or long fur?
Why does he call me ugly but wants to go back out with me?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
How much is the 2010 mustang?
How old is brianna gentilella?
What contact force always acts against the direction of movement?
What is the weaknesses of prince Caspian?
You have small white spot on arm from last 6 months?
What is the word that rhymes with droll that means a long stick?
Bones are made of which compound?
Does cooking an egg reduce protein level?
Where do vast majority of volcanic eruptions occur in relation to the earths surface?
What is show not tell to describe fire burning?
Who were heroic in 'Antigone'?
What are the best ways to replace Christmas lights bulbs to keep your holiday decorations looking bright and festive?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.