answersLogoWhite

0

What what is the you.s.a's population to the nearest million?

User Avatar

Anonymous

∙ 7y ago
Updated: 10/17/2024

It is 325 million.

User Avatar

Wiki User

∙ 7y ago
Copy

What else can I help you with?

Related Questions

What is Egypt population to nearest million?

82 million.


What is Sydney's population to the nearest million?

It is 4 million.


What is the population of Germany rounded to the nearest million?

81 million


What is China's population to the nearest million?

1379 million


What is New Zealand's population to the nearest million?

It is 4 million.


What is the current population of Australia to the nearest 100 million?

The population of Australia is about 21.5 million.


What is the US's population to the nearest million?

For 2017 it was estimated at 325 million.


What is the population in India to the nearest million?

1,237,000,000 as of 2012


What is the current population of Wisconsin rounded to the nearest one million?

approximately 6 million


What is China's population to the nearest 100 million?

so 1,300,000,000


What is Virginia's population in 2010?

rounded to nearest million 9,000,000


What is the population of NSW by the nearest million?

New South Wales is the most populous state in New South Wales, Australia. As of December of 2013, the population was just shy of seven and a half million.

Trending Questions
How do you break the habit of picking your nose? Is 3 mm bigger then 3m? Where in Seattle can I refill printer cartridges? What is an Example of Legal but unethical behavior? How do you stop squirrels from eating your pumpkins? What former player wore jersey number 11 for the dallas cowboys? How many prokaryotic domains are there? What is the meaning of 'Je Vous Aime'? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you judge the form of address to use with your clients? How long does it take for carmex to heal a gunshot wound? When did the government start to become deeply involved in business for the first time? Who is always happy when things go wrong? What time did Mount Tambora happen? What is the song hurricane by 30 seconds to mars about? What are the surnames on Friends tv show? What is the name of the lead singer from Down With Webster? Is buying stock in dodge motor company a good investment? Is valentino lanus married with jacqualine bracamontes? Is the Acer AS5742-6440 laptop good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.