answersLogoWhite

0

Can a even number be a prime number?

User Avatar

Anonymous

∙ 13y ago
Updated: 10/17/2024

Yes, 2 is a Prime number and an even number.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

Can a even number connot be a prime number?

2 is even, and it is a prime number. No other even number is prime, since by definition, an even number has 2 as a factor.


Is number on e a prime or even number?

The number 1 is prime, but not even.


Is 992 a prime number?

No. No even number can be prime and 992 is an even number.


Does every prime number have one even prime number?

No. The only even prime number is 2.


Is a 14 a prime number?

No. 14 is an even number and the ONLY even prime is 2.


Can an Even number be prime why?

Yes it can. 2 is an even number and it is prime.


Is 7 a prime number and a even number?

7 is prime and not even.


Which number is even and prime?

2 is the only prime number that is even.


Is 1990 prime or even?

1,990 is NOT a prime number but it is an even number.


Is 2548 a prime number?

No. It is an even number. The only even number that is prime is the number 2.


Which prime number is present in even number?

The only even prime number is 2


What is the one prime even number?

2 is one prime even number.

Trending Questions
How do you break the habit of picking your nose? Is 3 mm bigger then 3m? Where in Seattle can I refill printer cartridges? What is an Example of Legal but unethical behavior? How do you stop squirrels from eating your pumpkins? What former player wore jersey number 11 for the dallas cowboys? How many prokaryotic domains are there? What is the meaning of 'Je Vous Aime'? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you judge the form of address to use with your clients? How long does it take for carmex to heal a gunshot wound? When did the government start to become deeply involved in business for the first time? Who is always happy when things go wrong? What time did Mount Tambora happen? What is the song hurricane by 30 seconds to mars about? What are the surnames on Friends tv show? What is the name of the lead singer from Down With Webster? Is buying stock in dodge motor company a good investment? Is valentino lanus married with jacqualine bracamontes? Is the Acer AS5742-6440 laptop good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.