0
What else can I help you with?
Related Questions
What does 2 tens and 13 ones add up to?
2 tens and 13 ones add up to 33 because 10 +10 +13 = 33.
What two numbers multiply into -30 and add up to 13?
The two numbers that multiply to -30 and add up to 13 are 15 and -2. When you multiply 15 and -2, you get -30, and when you add them together, you get 13.
Three Numbers that add up to 39?
13+13+13=39
What is 2 coins add up to 11cent?
2 coins add up to 11cent = 13
What two numbers multiply to -48 and add up to 13?
The two numbers that multiply to -48 and add up to 13 are 16 and -3. When you multiply them, (16 \times -3 = -48), and when you add them, (16 + (-3) = 13).
Which two numbers add up to 13 and multiply to 6?
19
What is 13 and 15?
They add up to 28
What are 2 composite numbers that add to give 13?
9 and 4 add up to give 13.
What and 5 plus 8?
They add up to 13
What is a multiple of 6 and a factor of 12 that add up to 13?
It is: 12+1 = 13
What two square numbers add up to 13?
The two square numbers which add up to 13 are 9 (which is equal to 3 squared), and 4 (which is equal to 2 squared).
Which 3 prime numbers add up to 43?
13, 17, and 13. 13+13 = 26 + 17 = 43
Trending Questions
Top school in Karachi?
What happen when you mix Robitussin an sprite?
What team holds the record for the most turnovers in an NFL game?
Were australians for or against World War 1?
Who wrote thatpeople can and should govern themselves?
What professional group governs the Central Reserve Depository Institutions?
What is the Politically correct way of saying deaf?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What was it about Franklin Delano Roosevelt that stunned Stalin and Churchill at the Yalta Conference in February of 1944?
Is happy hour at sonic everyday?
In a life estate does the owner of real property still own the property if he has quit claimed the property to the remaindermen?
Advantages of capital from profits?
Will a penny rust in apple juice?
What is a pooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo?
Komodo dragon is a snake true or false?
How much does it cost to service jet engine?
What is the processor executes instaction frequency?
Can you provide some melodic dictation examples for practice?
What is semto?
What are the important aspects of a responsible citizenship in education?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.