answersLogoWhite

0

How do you show percent error?

User Avatar

Anonymous

∙ 16y ago
Updated: 10/17/2024

Percent error = (actual value - theoretical value) / theoretical value * 100%

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

What is relative errors?

Percent error.


What is the difference between low percent error and high percent error?

The difference between low percent error and high percent error is one is low and the other is high


Why are percent error values never negative?

all error value are suppose to be prefixed by a +/- symbol to show that they can be either + or -. As everybody understands this they just forget about it.


When an error of 1 percent is made in the length of a square error is?

The error in its area is then 2 percent....


What is 2 percent error OF 5 percent error?

1/100


What relative error?

percent error


Are percent deviation and percent error the same?

no


Is percent deviation the same as percent error?

No.


What is a high percent error mean?

high percent error is the absolute value of something that is multiplied


What is the percentage error of 12m?

what is the percent error of 12m


Can the answer of a percent error problem be 300?

Yes, your percent error can be over 100%. This means that somewhere during your experiment you made a big error.


What is percent error if you use a value of 3.14 for 3.14?

If you mean percent error of 3.14 versus pi, which is 3.14159..., the error is only 0.05%

Trending Questions
Is the gogli aperatus the same thing as the gogli complex? How many tens are there in 220? What is a famous quote of baron von stuebon? If a guy you like gives you a back rub does this mean he like you? What is a good love song for a forty-fifth wedding anniversary? What day of the week was June 11 1975? The body of water east of the Everett Mountains and on Baffin Island? How do you know what mate is the right one for you? When uranium-238 is transformed into thorium-234 it is represented by a balanced equation What is missing from the equation of U-238 undergoing radioactive decay? What is the zip code for Wisconsin Rapids Wisconsin? How much are Pro dancers supposed to weigh? What is the formula for matter? What inspired Natalie babbitt to begin write stories? How can conditioned beer be properly stored to maintain its quality and flavor? What nicknames does Richard Denson go by? He supported a national bank and protective tariffs? What is the weight of a sheep's heart? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? What are the practical implications of a material having a low modulus of elasticity? What role does cell division play with a starfish?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.