0
What else can I help you with?
Related Questions
The other name of latitude?
The lines of latitiude are also called 'parallels'.
What is 0 degree line called?
the equator
What is 0 degree angle is called?
A straight line
What do you call a 0 degree angle?
A 0 degree is a angle called a straight line but 180 degree is a straight line too. So cool yeah
What is the lines of latitude called?
The 0 degree line of Latitude is called the Equator.
What is another name for a line of latitiude?
parallels
What is the latitiude for mt Kilimanjaro?
3o4'33" south
What is the smallest climate?
the equator because it has a low latitiude
What is name of the angle which is between 0 degree to 90 degree?
It's called an acute angle.An Acute angle.
How does the latitiude effect the climate?
mostly becaus of the sea currents
What is found at 23.5 degrees north latitiude?
Tropic of Cancer
What do you call 0 degrees latitude and longitude?
The point where the equator crosses the prime meridian is known as the Null Island, with coordinates (0, 0). It is a fictional island and serves as a placeholder for data where coordinates are invalid or not available.
Trending Questions
What is an example of paradoxes?
What part of an element determines its ability to combine with other elements?
How do you Manage copper levels in a hot tub?
Why is a younger person less susceptible to the effect of alcohol as compared to an elderly person?
What kinds of credit cards allow one to apply online?
What should I do if my dog is tired and has a dry nose?
2 cups is equal to how many ml's?
50 ml of hcl is titrated with a solution of 0.24 m naoh it requires 35 ml of naoh to reach the equivalence point what is the concentration of the hcl solution?
Who was Athena' rival in the city-state?
What is a recipe from colonial Rhode Island?
Is there a 1.5 ddis suzuki jimny in a right hand drive version available in the UK?
What is P0153 codes on Toyota Sienna 3.0 engine?
Which concept did the Maya understand before europeans?
What is 12times 8?
Does Jon Gruden still get paid from the buccaneers?
How can I find a replacement head for my Kobalt weed eater?
Why is my kitten growling while playing?
How do you define global environmental scan.?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What happened to st therese of lisieux when she was 4?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.