0
What else can I help you with?
Related Questions
What divided by 3 equalls 27?
It is: 81/3 = 27
Nicks gasoline storage tank holds 1215 liters of gasoline If he can fill up his tractor 27 times with the gas in the storage tank how many liters of gasoline does the tractor hold?
1215/27 = 45
What times 2 equalls 320?
It is: 160 times 2 = 320
What times what equalls 125?
5 x 25
What times what equalls 120?
12 x 10
What times 7 equalls 4.9?
0.7 x 7 = 4.9
What times 8 equalls 100?
12.5 x 8 = 100
What number is in the 15 times table and 27 times table?
All multiples of the lowest common multiple of 15 and 27 are in both their times tables. The lcm of 15 and 27 is 135, so all multiples of 135 are in both the 15 and 27 times tables: 135, 270, 405, 540, 675, 810, 945, 1080, 1215, 1350, ...
What is 3 times 2025?
3 times of 2025 is 3 * 2025 equalls 6075
What is the radius of a circle with a circumference of 150.72?
circumference, 2 * pi * r equalls 150.72 r equalls 150.72 * 7 / 2 * 22 equalls 23.97cm r equalls 23.97cm
Wyat goes into 1215?
1, 3, 5, 9, 15, 27, 45, 81, 135, 243, 405, 1215.
What times what equalls 243?
81 x 3 = 243 is just one of many answers.
Trending Questions
What are the key teachings of St. Paul?
Who made the Korean language?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What causes tingling on head?
Which is an example of partisanship?
Where did the Prophet Ezekiel die?
What is the distance from Washington DC to Harrisonburg VA?
How much is child maintance?
What happen if coil and capacitor are connected in series?
This is the base of a word after all prefixes or suffixes are removed.?
What does intradependence mean?
What does Lo on a Kenmore dishwasher mean?
What does having osteoarthritis in both hips both knees and the back in a 36 year old male mean?
When are you 8 months pregnant how many weeks?
What actors and actresses appeared in Zombie Nightmare Revisited - 2010?
Thymine into Uracil or vice verse?
Can you use T-90 coax cable for satellite TV?
What help does new orlaens need?
How many calories does a super sized fry has?
What is the only hormone stored by the gland that produces it?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.