0
What else can I help you with?
Related Questions
What is the equivalent fraction to 6?
The equivalent fraction for 6 is 6/1 or 12/2
What is the equivalent fraction for 6 9 and 2 6?
12/18 is a equivalent fraction for 6/9. 4/12 is a equivalent fraction for 2/6
what fraction is equivalent to 4/6?
0.6667
What is the equivalent fraction for 6 24?
equivalent fraction for 6/24 = 1/4
What an equivalent fraction for 6-7?
equivalent fraction of 6/7 = 12/14
Is 6 over 22 an equivalent fraction?
6/22 can be an equivalent fraction. For instance, 6/22 is equivalent to 3/11
Is there equivalent fractions for 6 over 36?
6/36 IS the equivalent fraction to ' 1/6' . Fraction ARE Always reduced to their simplest form!!!!!
What is the equivalent fraction of 6 out of 12?
The equivalent fraction is 1/2.
What is an equivalent fraction to 6 eighths?
The equivalent fraction is 3 fourths
What is the next fraction that is equivalent to 4 out of 6?
If the denominator is reduced the next equivalent fraction to 4/6 is 2/3 If the denominator is increased the next equivalent fraction to 4/6 is 6/9
What is the improper fraction with a denominator of 6 that is equivalent to 5.5?
The improper fraction with a denominator of 6 that is equivalent to 5.5 is 33/6
What is the equivalent fraction for 3 6?
equivalent fraction for 3/6 = 1/2
Trending Questions
Top school in Karachi?
What happen when you mix Robitussin an sprite?
What team holds the record for the most turnovers in an NFL game?
Were australians for or against World War 1?
Who wrote thatpeople can and should govern themselves?
What professional group governs the Central Reserve Depository Institutions?
What is the Politically correct way of saying deaf?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What was it about Franklin Delano Roosevelt that stunned Stalin and Churchill at the Yalta Conference in February of 1944?
Is happy hour at sonic everyday?
In a life estate does the owner of real property still own the property if he has quit claimed the property to the remaindermen?
Advantages of capital from profits?
Will a penny rust in apple juice?
What is a pooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo?
Komodo dragon is a snake true or false?
How much does it cost to service jet engine?
What is the processor executes instaction frequency?
Can you provide some melodic dictation examples for practice?
What is semto?
What are the important aspects of a responsible citizenship in education?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.