answersLogoWhite

0

What else can I help you with?

Continue Learning about Math & Arithmetic

What is the function of the chromatain?

The chromatain have four major functions. They package DNA into a smaller volume to fit in the cell. They strengthen the DNA to allow mitosis, and they prevent damage to DNA. Chromatain control gene expression and DNA replication.


What does the Pentagon represent in a DNA picture?

In a DNA picture, a pentagon often represents a specific structural element, such as a sugar molecule in the DNA backbone. DNA is composed of nucleotides, which include a phosphate group, a sugar, and a nitrogenous base. The pentagon symbolizes the five-carbon sugar (deoxyribose) that is integral to forming the DNA structure. Thus, the pentagon visually highlights the molecular architecture that supports genetic information.


What are four charactoristics of eubacteria?

eubacteria lack a nucleus, lack histones in their DNA, have no membrane bound organelles, and their DNA is in a circular form.


Describe the function of electricity and the agarose gel in electrophoresis?

The electricity pulls the polar DNA strands through the gel, and shorter DNA strands move farther because they are less inhibited by the gel. The gel acts as drag to separate the different length DNA strands, so different DNA creates specific dye bands.


What is the function of primers?

RNA primers are used to initiate the DNA replication at the template strand. DNA molecules require a free 3' OH, to which it could add the nucleotides. This free 3' OH is provided by the RNA primer. So prior to the synthesis of DNA a short fragment of RNA is synthesized that is later excised and filled with DNA molecules.

Related Questions

Dyad axis DNA nucleosome?

The Nucleosome has an approximate two fold axis of symmetry which is called the Dyad Axis. So when you rotate the Nucleosome by 180 degree you would observe the similar view of Nucleosome before the rotation.


What is the difference between monad dyad and tetrad?

Chromosomes come in 2 forms, depending on the stage of the cell cycle. The monad form consists of a single chromatid, a single piece of DNA containing a centromere and telomeres at the ends. The dyad form consists of 2 identical chromatids (sister chromatids) attached together at the centromere. Chromosomes are in the dyad form before mitosis, and in the monad form after mitosis. The dyad form is the result of DNA replication: a single piece of DNA (the monad chromosome) replicated to form 2 identical DNA molecules (the 2 chromatids of the dyad chromosome). a tetrad is a pair of homologous chromosomes that have replicated and come together in prophase I of meiosis; and consists of four chromatids.


What does it mean that all restriction sites are palindromic?

It means that the sequences of DNA at restriction sites read the same forwards and backwards. This symmetry allows enzymes to cut the DNA at these sites in a specific way.


Why do people crave symmetry?

People crave symmetry in aesthetics because it is often associated with beauty, balance, and harmony. Humans are naturally drawn to symmetry because it is pleasing and easy for the brain to process. It is considered a universal element of attractiveness across cultures.


Are Nitrogenous bases always located perpendicular to the helical axis?

As far as I know, the polar sugar-phosphate backbones of each strand form the helical scaffold, with the nitrogenous bases in the interior of the molecule, their planes nearly perpendicular to the helical axis. However, I cannot sure that it always does. I am curious that there are some exceptional cases.


The shape of a DNA is known as what?

People usually refer to its shape as a double helix.


What does a DNA nucleotide look like?

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT


What are pseudo allele?

Pseudo alleles are variant sequences that result from sequencing errors or artifacts, leading to apparent genetic variations that are not biologically meaningful. These errors can arise during the process of DNA sequencing, and researchers need to be aware of and filter out such artifacts when analyzing genetic data.


What are the two pieces of information from other scientists that enabled James Watson and Francis Crick to discover helical structure of DNA?

the two strands of nucleotides twisting around a central axis.


What requires a binding site called palindrome?

DNA polymerase requires a binding site called palindrome. This binding site allows the enzyme to recognize and bind to specific sequences on the DNA strand in a complementary manner, ensuring accurate copying of genetic information during DNA replication. Palindromic sequences are characterized by their two-fold symmetry, which aids in DNA polymerase's ability to bind and initiate replication.


The bases are paired by what bonds along the axis of the molecule?

The bases in DNA are paired by hydrogen bonds along the axis of the molecule. Adenine pairs with thymine (or uracil in RNA) through two hydrogen bonds, while guanine pairs with cytosine through three hydrogen bonds.


What is the double helix?

The double helix refers to the twisted-ladder structure of DNA, consisting of two strands that are wound around each other. This structure allows DNA to be compactly packaged within the cell while also providing a mechanism for DNA replication and transcription. James Watson and Francis Crick are credited with discovering the double helix structure of DNA in 1953.