0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the function of the chromatain?
The chromatain have four major functions. They package DNA into a smaller volume to fit in the cell. They strengthen the DNA to allow mitosis, and they prevent damage to DNA. Chromatain control gene expression and DNA replication.
Describe the function of electricity and the agarose gel in electrophoresis?
The electricity pulls the polar DNA strands through the gel, and shorter DNA strands move farther because they are less inhibited by the gel. The gel acts as drag to separate the different length DNA strands, so different DNA creates specific dye bands.
What are four charactoristics of eubacteria?
eubacteria lack a nucleus, lack histones in their DNA, have no membrane bound organelles, and their DNA is in a circular form.
What is the function of primers?
RNA primers are used to initiate the DNA replication at the template strand. DNA molecules require a free 3' OH, to which it could add the nucleotides. This free 3' OH is provided by the RNA primer. So prior to the synthesis of DNA a short fragment of RNA is synthesized that is later excised and filled with DNA molecules.
Which series is arranged in order from largest to smallest in size 1chromosome nucleus cell DNA nucleotide?
cell, nucleus, chromosome, DNA, nucleotide
Dyad axis DNA nucleosome?
In a DNA nucleosome, the DNA double helix is wrapped around a core of histone proteins forming a structure known as a nucleosome. The dyad axis refers to the central point of symmetry within the nucleosome where the DNA helix is bent and connected by a histone protein. This bending allows for tight packaging of DNA while still maintaining accessibility for regulation and transcription.
What is the difference between monad dyad and tetrad?
**In the context of music, specifically harmony, a monad, dyad, and tetrad refer to different types of chord structures: **Monad**: A monad is the simplest type of chord, consisting of a single note played simultaneously. It essentially represents a single pitch played on its own. *Dyad*: A dyad is a chord consisting of two notes played simultaneously. Dyads are often called intervals when they consist of two different pitches. The most basic dyad is the interval of a perfect octave, where two notes are played with a frequency ratio of 2:1. *Tetrad*: A tetrad, also known as a four-note chord or seventh chord, consists of four different pitches played simultaneously. These chords often add richness and complexity to music compared to simpler chords like monads and dyads. There are various types of tetrads, including major seventh chords, minor seventh chords, dominant seventh chords, and diminished seventh chords, each with its own distinctive sound and harmonic function. In summary, the main difference between a monad, dyad, and tetrad lies in the number of notes they contain, with monads having one note, dyads having two notes (or intervals), and tetrads having four notes.**
Why do people crave symmetry?
People crave symmetry in aesthetics because it is often associated with beauty, balance, and harmony. Humans are naturally drawn to symmetry because it is pleasing and easy for the brain to process. It is considered a universal element of attractiveness across cultures.
The study of human races and their characteristics?
The study of human races and their characteristics is known as anthropology or physical anthropology. It includes researching genetic, physical, and cultural differences among human populations. However, it is essential to note that the concept of race is a social construct and not a scientifically valid biological category.
Are Nitrogenous bases always located perpendicular to the helical axis?
Yes, in a DNA double helix, nitrogenous bases are always positioned perpendicular to the helical axis. This orientation allows for the hydrogen bonding between complementary bases on the two strands, which stabilizes the structure of the DNA molecule.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
What are pseudo allele?
Pseudo alleles are variant sequences that result from sequencing errors or artifacts, leading to apparent genetic variations that are not biologically meaningful. These errors can arise during the process of DNA sequencing, and researchers need to be aware of and filter out such artifacts when analyzing genetic data.
What are the two pieces of information from other scientists that enabled James Watson and Francis Crick to discover helical structure of DNA?
the two strands of nucleotides twisting around a central axis.
What is the double helix?
The double helix refers to the twisted-ladder structure of DNA, consisting of two strands that are wound around each other. This structure allows DNA to be compactly packaged within the cell while also providing a mechanism for DNA replication and transcription. James Watson and Francis Crick are credited with discovering the double helix structure of DNA in 1953.
What are two pieces of information from other scientist that enabled James Watson and Francis Crick to discover the double helical structure of DNA?
Rosalind Franklin's X-ray diffraction images of DNA provided the crucial information about the helical structure of DNA, including the angle of the helix and the repeating pattern of the molecule. Erwin Chargaff's discovery that the amount of adenine is equal to the amount of thymine, and the amount of cytosine is equal to the amount of guanine in DNA, helped Watson and Crick understand the base pairings in DNA.
What is secret pseudo protein code?
Secret pseudo protein code (SPPC) is a method used to conceal the true amino acid sequence of a protein by encoding it using a different set of codons. This can be useful for protecting intellectual property related to protein sequences or for creating synthetic proteins with specific properties without revealing the exact amino acid sequence.
What do the structures labeled with the letters represent?
the tertiary structure of DNA include A- B- Z form which differ from each other in geometric according to bases sequences of DNA and condition DNA present in Form A :right handed double helix Most RNA present in this form Major conformation of RNA the most favorable conformation at low concentration of water Bases are displaced away from the axis Major groove is narrow while minor groove is wide Over all shape short and wide Form B : Right handed double helix the most common type of DNA Major conformation of DNA the most favorable conformation at high concentration of water Bases are perpendicular to the axis Major groove is wide while minor groove is narrow Over all shape is long and narrow Form z : Left handed double helix Zigzag form Minor conformation of DNA the most favorable conformation at high concentration of salt Bases are perpendicular to the axis Both major and minor groove are narrow Over all shape is elongate and narrow
