0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the function of the chromatain?
The chromatain have four major functions. They package DNA into a smaller volume to fit in the cell. They strengthen the DNA to allow mitosis, and they prevent damage to DNA. Chromatain control gene expression and DNA replication.
What are four charactoristics of eubacteria?
eubacteria lack a nucleus, lack histones in their DNA, have no membrane bound organelles, and their DNA is in a circular form.
Describe the function of electricity and the agarose gel in electrophoresis?
The electricity pulls the polar DNA strands through the gel, and shorter DNA strands move farther because they are less inhibited by the gel. The gel acts as drag to separate the different length DNA strands, so different DNA creates specific dye bands.
What is the function of primers?
RNA primers are used to initiate the DNA replication at the template strand. DNA molecules require a free 3' OH, to which it could add the nucleotides. This free 3' OH is provided by the RNA primer. So prior to the synthesis of DNA a short fragment of RNA is synthesized that is later excised and filled with DNA molecules.
Which series is arranged in order from largest to smallest in size 1chromosome nucleus cell DNA nucleotide?
cell, nucleus, chromosome, DNA, nucleotide
Dyad axis DNA nucleosome?
In a DNA nucleosome, the DNA double helix is wrapped around a core of histone proteins forming a structure known as a nucleosome. The dyad axis refers to the central point of symmetry within the nucleosome where the DNA helix is bent and connected by a histone protein. This bending allows for tight packaging of DNA while still maintaining accessibility for regulation and transcription.
What is the difference between monad dyad and tetrad?
**In the context of music, specifically harmony, a monad, dyad, and tetrad refer to different types of chord structures: **Monad**: A monad is the simplest type of chord, consisting of a single note played simultaneously. It essentially represents a single pitch played on its own. *Dyad*: A dyad is a chord consisting of two notes played simultaneously. Dyads are often called intervals when they consist of two different pitches. The most basic dyad is the interval of a perfect octave, where two notes are played with a frequency ratio of 2:1. *Tetrad*: A tetrad, also known as a four-note chord or seventh chord, consists of four different pitches played simultaneously. These chords often add richness and complexity to music compared to simpler chords like monads and dyads. There are various types of tetrads, including major seventh chords, minor seventh chords, dominant seventh chords, and diminished seventh chords, each with its own distinctive sound and harmonic function. In summary, the main difference between a monad, dyad, and tetrad lies in the number of notes they contain, with monads having one note, dyads having two notes (or intervals), and tetrads having four notes.**
Why do people crave symmetry?
People crave symmetry in aesthetics because it is often associated with beauty, balance, and harmony. Humans are naturally drawn to symmetry because it is pleasing and easy for the brain to process. It is considered a universal element of attractiveness across cultures.
Are Nitrogenous bases always located perpendicular to the helical axis?
Yes, in a DNA double helix, nitrogenous bases are always positioned perpendicular to the helical axis. This orientation allows for the hydrogen bonding between complementary bases on the two strands, which stabilizes the structure of the DNA molecule.
The shape of a DNA is known as what?
The shape of DNA is known as a double helix, consisting of two strands that coil around a central axis. The structure was first described by James Watson and Francis Crick in 1953.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
What are pseudo allele?
Pseudo alleles are variant sequences that result from sequencing errors or artifacts, leading to apparent genetic variations that are not biologically meaningful. These errors can arise during the process of DNA sequencing, and researchers need to be aware of and filter out such artifacts when analyzing genetic data.
What are the two pieces of information from other scientists that enabled James Watson and Francis Crick to discover helical structure of DNA?
the two strands of nucleotides twisting around a central axis.
What requires a binding site called palindrome?
DNA polymerase requires a binding site called palindrome. This binding site allows the enzyme to recognize and bind to specific sequences on the DNA strand in a complementary manner, ensuring accurate copying of genetic information during DNA replication. Palindromic sequences are characterized by their two-fold symmetry, which aids in DNA polymerase's ability to bind and initiate replication.
The bases are paired by what bonds along the axis of the molecule?
The bases in DNA are paired by hydrogen bonds along the axis of the molecule. Adenine pairs with thymine (or uracil in RNA) through two hydrogen bonds, while guanine pairs with cytosine through three hydrogen bonds.
What is the double helix?
The double helix refers to the twisted-ladder structure of DNA, consisting of two strands that are wound around each other. This structure allows DNA to be compactly packaged within the cell while also providing a mechanism for DNA replication and transcription. James Watson and Francis Crick are credited with discovering the double helix structure of DNA in 1953.
What are two pieces of information from other scientist that enabled James Watson and Francis Crick to discover the double helical structure of DNA?
Rosalind Franklin's X-ray diffraction images of DNA provided the crucial information about the helical structure of DNA, including the angle of the helix and the repeating pattern of the molecule. Erwin Chargaff's discovery that the amount of adenine is equal to the amount of thymine, and the amount of cytosine is equal to the amount of guanine in DNA, helped Watson and Crick understand the base pairings in DNA.
