Want this question answered?
Assuming each term is 3 MORE than the previous term t(n) = -13 + 3*n where n = 1, 2, 3, ...
polygons that have corresponding angles congruent and corresponding sides proportional
an adjacent corresponding angle is an angle which is adjacent to a particular angle as well as corresponding.
False. The statement should be: If the corresponding side lengths of two triangles are congruent, and the triangles are similar, then the corresponding angles are also congruent.
A corresponding angle is related to a primary angle. Subtract the primary angle measure from 180 degrees, to obtain the corresponding angle measure.
The corresponding mRNA sequence of ATGCCCTAAGTG is UACGGGAUUCAC
ATGGCGAA for DNA AUGGCGAA for RNA
The corresponding sequence to CTAACG is GAUUGC. This is because in RNA, adenine (A) pairs with uracil (U) instead of thymine (T).
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
a codon is a sequence of 3 nucleotides, the tRNA anticodons is the comlementary pairs with its corresponding mRNA codon.
Transcription.
The genetic code is redundant
The corresponding mRNA strand would be AUCG.
tttactgttgatggtagaactcgttgttct
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
ATAGCC is complementary to the base sequence TATCGG.
To provide necessary context, the original question was "What letter comes next in this sequence? WLCNIT_" Notice the first letter of each word in that question. The answer is S, corresponding to "sequence."