0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the next letter in the sequence pattern 1 I 2 L 3 F 4?
The sequence pattern appears to be alternating between a number and its corresponding letter in the alphabet. The numbers 1, 2, 3, 4 correspond to the letters A, B, C, D. Therefore, the next letter in the sequence would be E.
What is the simple formula corresponding to the explicit formula if the first term of the sequence is -10 and the difference between terms in the sequence is 3?
Assuming each term is 3 MORE than the previous term t(n) = -13 + 3*n where n = 1, 2, 3, ...
What polygons that have corresponding angels congruent and corresponding sides proportional?
polygons that have corresponding angles congruent and corresponding sides proportional
What is an adjacent corresponding angle?
an adjacent corresponding angle is an angle which is adjacent to a particular angle as well as corresponding.
If the corresponding side lengths of two triangles are congruent the corresponding angles are also congruent.?
False. The statement should be: If the corresponding side lengths of two triangles are congruent, and the triangles are similar, then the corresponding angles are also congruent.
What is the corresponding sequence to the base sequence TACCGCTT?
ATGGCGAA for DNA AUGGCGAA for RNA
What is the corresponding mRNA sequence to ATGCCCTAAGTG of an unraveled section of DNA?
The corresponding mRNA sequence to ATGCCCTAAGTG is UACGGGAUUCA. Remember to use the complementary RNA base pairs: A-U, T-A, G-C, and C-G.
What is the corresponding sequence to CTAACG?
The corresponding sequence to CTAACG is GAUUGC. This is because in RNA, adenine (A) pairs with uracil (U) instead of thymine (T).
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
The corresponding messenger RNA sequence for the DNA sequence GCTTAA will be CGAAUU. This is because in RNA, adenine (A) pairs with uracil (U) instead of thymine (T) as in DNA.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
The DNA sequence for the corresponding strand would be TCCGGTAATCGGGATAAGCCCATATTTACC. This is the complementary sequence, where each nucleotide is paired with its complementary base (A with T and C with G).
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
How do you write the amino acid sequence for u-g-a-u-g-g-g-u-a-c-g-g-u-c?
The given sequence "U-G-A-U-G-G-G-U-A-C-G-G-U-C" represents the RNA sequence, not the amino acid sequence. To determine the corresponding amino acid sequence, you would need to perform translation by converting the RNA sequence into its complementary DNA sequence, then group the nucleotides into codons, and use the genetic code to find the corresponding amino acids.
What is the puorpose of anticodons?
a codon is a sequence of 3 nucleotides, the tRNA anticodons is the comlementary pairs with its corresponding mRNA codon.
In DNA what process does the corresponding sequence a-c-t-t-g to t-g-a-a-c occur?
Transcription.
What is the base sequence at the 3' end of all tRNAs?
The base sequence at the 3' end of all tRNAs is CCA. This sequence is added post-transcriptionally during tRNA processing and is important for tRNA charging with the corresponding amino acid.
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
