answersLogoWhite

0

The corresponding sequence of the DNA strand "tcacgtatgc" can be determined by finding its complementary base pairs. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary sequence is "agtgcatacg."

User Avatar

AnswerBot

3mo ago

What else can I help you with?

Continue Learning about Math & Arithmetic

What is a corresponding term?

A corresponding term refers to an element or value that is related to another within a particular context, such as in sequences, sets, or functions. For example, in two parallel sequences, the corresponding term of one sequence is directly aligned with a term in the other sequence based on their positions. This concept is often used in mathematics and logic to establish relationships between different entities.


Which 3 letters will complete this sequence shsmcdpro?

The sequence "shsmcdpro" appears to alternate between letters that represent the first letter of each word in the phrase "She sells sea shells by the sea shore." The next three letters that would complete the sequence are likely "ssw," corresponding to "sea," "shore," and "waves."


What is the next letter in the sequence pattern 1 I 2 L 3 F 4?

The sequence pattern appears to be alternating between a number and its corresponding letter in the alphabet. The numbers 1, 2, 3, 4 correspond to the letters A, B, C, D. Therefore, the next letter in the sequence would be E.


What is the simple formula corresponding to the explicit formula if the first term of the sequence is -10 and the difference between terms in the sequence is 3?

Assuming each term is 3 MORE than the previous term t(n) = -13 + 3*n where n = 1, 2, 3, ...


What polygons that have corresponding angels congruent and corresponding sides proportional?

polygons that have corresponding angles congruent and corresponding sides proportional

Related Questions

What is the corresponding sequence to the base sequence TACCGCTT?

ATGGCGAA for DNA AUGGCGAA for RNA


What is the corresponding mRNA sequence to ATGCCCTAAGTG of an unraveled section of DNA?

The corresponding mRNA sequence of ATGCCCTAAGTG is UACGGGAUUCAC


What is the corresponding sequence to CTAACG?

The corresponding sequence to CTAACG is GAUUGC. This is because in RNA, adenine (A) pairs with uracil (U) instead of thymine (T).


A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?

RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU


What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?

I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.


DNA sequence acgtt will give what mRNA base sequence?

The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.


What is the correct match for the following sequence if you were converting to RNA the sequence is CGTTAA?

To convert the DNA sequence CGTTAA to RNA, you would replace thymine (T) with uracil (U). Therefore, the corresponding RNA sequence would be CGUUAA.


How do you write the amino acid sequence for u-g-a-u-g-g-g-u-a-c-g-g-u-c?

The given sequence "U-G-A-U-G-G-G-U-A-C-G-G-U-C" represents the RNA sequence, not the amino acid sequence. To determine the corresponding amino acid sequence, you would need to perform translation by converting the RNA sequence into its complementary DNA sequence, then group the nucleotides into codons, and use the genetic code to find the corresponding amino acids.


What is a corresponding term?

A corresponding term refers to an element or value that is related to another within a particular context, such as in sequences, sets, or functions. For example, in two parallel sequences, the corresponding term of one sequence is directly aligned with a term in the other sequence based on their positions. This concept is often used in mathematics and logic to establish relationships between different entities.


What is the puorpose of anticodons?

a codon is a sequence of 3 nucleotides, the tRNA anticodons is the comlementary pairs with its corresponding mRNA codon.


In DNA what process does the corresponding sequence a-c-t-t-g to t-g-a-a-c occur?

Transcription.


What is the base sequence at the 3' end of all tRNAs?

The base sequence at the 3' end of all tRNAs is CCA. This sequence is added post-transcriptionally during tRNA processing and is important for tRNA charging with the corresponding amino acid.