answersLogoWhite

0

3' aatgcccaggtcagtacgct 5' is the complimentary strand.

User Avatar

Wiki User

10y ago

What else can I help you with?

Related Questions

What is the term for the 3' to 5' strand of DNA?

The term for the 3' to 5' strand of DNA is the "antisense strand."


What would be the complementary strand of 3 acgtgctacggtacg-5?

If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'


In which direction does replication occur 3 to 5 or 5 to 3?

Replication occurs in the 5' to 3' direction. The new DNA strand is synthesized in the 5' to 3' direction, while the parental template strand acts as the template for this synthesis. This directionality allows for continuous synthesis on one strand (leading strand) and discontinuous synthesis on the other strand (lagging strand).


What would the other strand of DNA be - g g t c g a a t?

5' GGTCGAAT 3' --Top strand 3 'CCAGCTTA 5' ---Other strand


What is the directionality of the nucleotide strand in terms of the 5' and 3' ends?

The nucleotide strand has directionality, with one end labeled as the 5' end and the other end as the 3' end. The direction of the strand goes from the 5' end to the 3' end.


What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?

To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.


Complementary strand of dna AAT?

Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?


What is the directionality of DNA synthesis when the template strand is read from 3' to 5'?

When the template strand of DNA is read from 3' to 5', DNA synthesis occurs in the 5' to 3' direction.


What is the strand of DNA that forms during replication 5' GGTTTCTTCAAGAGA '3?

The strand of DNA that forms during replication complementary to the sequence 5' GGTTTCTTCAAGAGA 3' is 3' CCAAGAACTTCTCTC 5'. During DNA replication, the new strand is synthesized in the 5' to 3' direction, pairing adenine with thymine and cytosine with guanine. Therefore, the complementary strand would be built from the corresponding bases of the original strand.


In which direction does RNA polymerase read a DNA strand?

The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.


What is the coding DNA and mrna strand for the template strand 3' a-g-g-t-t-c-a-t 5'?

The top strand, which is drawn 5' to 3' and which contains the promoter sequences in the conventionally written orientation (such as the TATA box) and which has the same sequence as the new RNA (except for U instead of T) is the plus strand or the sense strand or the non template strand or the coding strand. The bottom 3' to 5' strand is the minus, or template, or antisense strand. Your sequence therefore is the coding strand, but the RNA is transcribed off of the non-coding, template, or antisense strand.


RNA polymerase moves in which direction along the DNA?

RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing a new RNA strand in the 5' to 3' direction.