Wiki User
∙ 9y ago3' aatgcccaggtcagtacgct 5' is the complimentary strand.
Wiki User
∙ 9y ago5 - 3 and 3/5 = 1 and 2/5
1/3 of 5 add 5 = 1/3*5 + 5 = 5/3 + 5 = 12/3 + 5 = 62/3 or 20/3
5 * 5 - (3 / 3) = 24
√-3 - √5 = i√3 - √5 = -√5 + i√3
450 = 2*3*3*5*5450 = 2*3*3*5*5450 = 2*3*3*5*5450 = 2*3*3*5*5
If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'
5' GGTCGAAT 3' --Top strand 3 'CCAGCTTA 5' ---Other strand
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
The top strand, which is drawn 5' to 3' and which contains the promoter sequences in the conventionally written orientation (such as the TATA box) and which has the same sequence as the new RNA (except for U instead of T) is the plus strand or the sense strand or the non template strand or the coding strand. The bottom 3' to 5' strand is the minus, or template, or antisense strand. Your sequence therefore is the coding strand, but the RNA is transcribed off of the non-coding, template, or antisense strand.
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
An Okazaki fragment is a short, newly synthesized DNA fragment that is formed on the lagging strand during DNA replication. It is composed of a short RNA primer at the 5' end and DNA nucleotides that extend toward the replication fork.
During DNA replication, the new DNA strands are made of nucleotides. These nucleotides consist of a phosphate group, a sugar molecule (deoxyribose), and one of four nitrogenous bases (adenine, thymine, cytosine, or guanine). The nucleotides form complementary base pairs with the existing DNA strands to create two identical copies.
The complementary DNA strand to "ATTGCAT" would be "TAACGTA," where A pairs with T, T pairs with A, G pairs with C, and C pairs with G. This is because in DNA, adenine always pairs with thymine, and guanine always pairs with cytosine.
The complementary DNA strand would be TACCGGATC. DNA base pairs follow specific rules: A pairs with T and G pairs with C.
3-gttcacctta-5