0
Add your answer:
Earn +20 pts
What is 5 minus 3 and 3 5?
5 - 3 and 3/5 = 1 and 2/5
What is 1 third of 5 add 5?
1/3 of 5 add 5 = 1/3*5 + 5 = 5/3 + 5 = 12/3 + 5 = 62/3 or 20/3
How does 3 3 5 5 equal 24?
5 * 5 - (3 / 3) = 24
Subtract the square of 5 from the square of -3?
√-3 - √5 = i√3 - √5 = -√5 + i√3
What is the prime numbers of 450?
450 = 2*3*3*5*5450 = 2*3*3*5*5450 = 2*3*3*5*5450 = 2*3*3*5*5
What would be the complementary strand of 3 acgtgctacggtacg-5?
If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'
In which direction does replication occur 3 to 5 or 5 to 3?
Replication occurs in the 5' to 3' direction. The new DNA strand is synthesized in the 5' to 3' direction, while the parental template strand acts as the template for this synthesis. This directionality allows for continuous synthesis on one strand (leading strand) and discontinuous synthesis on the other strand (lagging strand).
What would the other strand of DNA be - g g t c g a a t?
5' GGTCGAAT 3' --Top strand 3 'CCAGCTTA 5' ---Other strand
Complementary strand of dna AAT?
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
What is the coding DNA and mrna strand for the template strand 3' a-g-g-t-t-c-a-t 5'?
The top strand, which is drawn 5' to 3' and which contains the promoter sequences in the conventionally written orientation (such as the TATA box) and which has the same sequence as the new RNA (except for U instead of T) is the plus strand or the sense strand or the non template strand or the coding strand. The bottom 3' to 5' strand is the minus, or template, or antisense strand. Your sequence therefore is the coding strand, but the RNA is transcribed off of the non-coding, template, or antisense strand.
RNA polymerase moves in which direction along the DNA?
RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing a new RNA strand in the 5' to 3' direction.
Which strand would be the template for the leading strand?
The leading strand would utilize the 3' to 5' template DNA strand as a guide for continuous synthesis of complementary DNA in the 5' to 3' direction by DNA polymerase during DNA replication.
How does DNA polymerase move along the DNA strand, from 3' to 5' direction, during replication?
DNA polymerase moves along the DNA strand in the 3' to 5' direction during replication by adding new nucleotides to the growing strand in a continuous manner. It reads the template strand in the 3' to 5' direction and synthesizes the new strand in the 5' to 3' direction. This process ensures accurate replication of the DNA molecule.
What is the complimentary strand of 5' ACCCGAAATTTG 3'?
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
How does polymerase move from 5' to 3' during DNA replication?
During DNA replication, polymerase moves along the template strand in the 3' to 5' direction, synthesizing the new strand in the 5' to 3' direction. This is because DNA polymerase can only add nucleotides to the 3' end of the growing strand.
