0
16
What else can I help you with?
Continue Learning about Natural Sciences
Related Questions
How many 4.5 oz in a pound?
1 pound = 16 ounce (or oz) 1 pound = 16/4.5 in 4.5 oz
How many oz go into 1 pound?
16 oz (ounces) = 1 lb (pound)
How many oz does a pound have?
16oz = 1 pound
1pound how many oz?
1 pound = 16 oz
Who many oz there are in a pound?
16 Ounces= 1 Pound
How many oz pound?
16 ounces = 1 pound
How many oz's in 1 lbs?
There are 16 oz. in 1 pound.
How many oz are in 1 pound?
There are 16 ounces in 1 pound.
How many oz equal 1 pound?
16 oz to a lb
How many oz equal pounds?
16 oz = 1 pound
How many pound in 48 oz?
there are 16 oz in one pound.........therefore 48 oz. = 3 lbs.
How many oz equal 1lb?
1 pound = 16 ounces
Trending Questions
What is uranium formed from?
How is vitamin K deficiency measured?
Is Eileen McShea still doing weather on WEWS?
What role do chloroplasts play in plant cells?
Does the state of minnesota observe Daylight Saving Time?
What is an example of a molecule produced?
What is homologous chromosomes frequently exchange portions of their DNA called?
What is the principle of common proportions?
When a child is born with a chromosomol mutation when did the mutation occur?
The variety of life across the biosphere is called?
How do you use a 100 ppm dilution to achieve 25ml of a 10 ppm dilution?
What are the Requirements of splicing connectors?
What organs pick up slack?
How did the environment of Greece influence the way the Ancient Greeks lived?
How do you grow Rhodospirillum rubrum?
Do hippopotamus really have poison teeth?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What are the organisms that survive reproduce and pass those variations to their offspring called?
If a cow develops a preference for eating white four oclock flowers and ignoring pink red four oclock flowers what types of selection is being demonstrated?
How many of hours of sunlight are there in August?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.