0
What else can I help you with?
Related Questions
What is the mean of 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 1 plus 2 plus 2 plus 2 plus 1 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2?
To find the mean (or average) you first add up the numbers you have. NOTHING 1.88
How do you find the sum of 1 plus 2 plus 3 plus 4 plus . plus 79?
Sum = 79*(79+1)/2 = 79*80/2 = 3160
If x 3 plus 2 3- 2 and y 3- 2 3 plus 2 find the value of x² plus y²?
98
If you have searched everywhere but you can not find the answer what is 1 plus 1?
1 plus 1 = 2
How do you find the slope of 2x plus 3x plus 6 equals 0?
-2
Factor this expression 2 plus 2y plus x plus xy?
2 plus 2y plus x plus x y = 2 plus3y plus 2x (find how many X's there are and add them together and ten Y's and then single numbers)
Find the intercept answer for x plus 2 equals y?
(0, 2)
What is the answer of 2 plus 2 equals x please find x?
4
Find the vertex of y equals x2 plus 10x plus 22?
-2-5
Find the sum of 1 plus 2 plus 3 plus . plus n nos using c program?
if (n%2==0) sum=n/2*(n+1); else sum=(n+1)/2*n;
Find the missing no plus 3 equals 5?
2
What is 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2 plus 2?
16 + 20 + 14 = 50 = 12 + 14 +14 + 10
Trending Questions
What age was Teresa Edwards when she started playing basketball?
Who does the voiceover for the new tesco advertisement?
How clean is the River Congo?
What is your zodiac sign for January 10th?
What does the term 'undercut' mean as related to golf clubs such as the King Cobra 3100 IH Undercut clubs?
What caused people to move to the north into the areas uncovered by ice sheets at the end of the last ice age?
What are some examples of letter of indefinite leave?
How can you be born before your father?
How do you remove Gator GAIN Claria permanently from computer?
What is the new name of Guys4Men online?
What does encanta mean in English?
What is the standard depth of a built-in bookshelf?
Does amphibian breathes through its lungs and lays its eggs on land and they has scaly and dry skin texture?
What year did Ozzy Osbourne go to prison?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
How do you make 548 using these numbers 4 4 4 9 9 9?
What is the meaning of remembrance?
What does laminated glass weight?
Is the square root of 8 a rational number?
The name of third crew member of Apollo-2 is?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.