0
If given the 10th term in the above geometric sequence which is 1536 what would you need to do to find the 11th term?
Wiki User
∙ 7y ago
To find any term of a geometric sequence from another one you need the common ration between terms:
t{n} = t{n-1} × r = t{1} × r^(n-1)
where t{1} is the first term
and n is the required term.
It depends what was given in the geometric sequence ABOVE which you have not provided us.
I suspect that along with the 10th term, some other term (t{k}) was given; in this case the common difference can be found:
t{10} = 1536 = t{1} × r^9
t{k} = t{1} × r^(k-2)
→ t{10} ÷ t{k} = (t{1} × r^9) ÷ (t{1} × r^(k-1))
→ t{10} ÷ t{k} = r^(10-k)
→ r = (t{10} ÷ t{k})^(1/(10-k))
Plugging in the values of t{10} (=1536), t{k} and {k} (the other given term (t{k}) and its term number (k) will give you the common ratio, from which you can then calculate the 11th term:
t{11} = t(1) × r^9 = t{10} × r
Wiki User
∙ 7y ago
Wiki User
∙ 7y agoYou would need the common ratio, which is typically denoted by r.Then, t11 = r*t10
Add your answer:
Earn +20 pts
How do you find the 99th nth term in a geometric sequence?
The 99th term would be a times r to the 98th power ,where a is the first term and r is the common ratio of the terms.
What is a successive ratio?
In a sequence, the ratio of the third term to the second term is the one successive from the ratio of the second to the first. The successive ratios are : u2/u1, u3/u2, u4/u3 and so on. In a geometric sequence, these would all be the same.
What is geometric terms?
Geometric Sequences work like this. You start out with some variable x. Your multiplication distance between terms is r. Your second term would come out to x*r, your third x*r*r, and so on. If there are n terms in the sequence, your final term will be x*r^(n-1).
What is the equation for finding the nth term of a nonlinear sequence?
There is no set equation for finding the nth term of a non- linear sequence. You have to go through a procedure to find the equation suitable for your given sequence. You would have to post the equation itself or re phrase your question for the answer.
What would the seventh term be in a geometric sequence with a3 equals 125 and r equals 5?
You have the 3rd term and you want to go out four more so multiply by 5 this many times: 125*5^4 = 78125
Is the sequence 1361015 geometric?
Of sorts. 1 3 6 10 15 would have a geometric representation, but would not fit the definition of a "geometric sequence". One example of a geometric representation of the sequence would be the number of total bowling pins as you add each row. The first row as 1 pin, the second has 2, then 3,4,5. 1 = 1 + 2 = 3 + 3 = 6 + 4 = 10 + 5 = 15
What is a geometric figure that have the shape of a party of hat?
A cone would fit the given description
Is this sequence 10 10.25 10.50625 10.76890625 arithmetic?
No, it is geometric, since each term is 1.025 times the previous. An example of an arithmetic sequence would be 10, 10.25, 10.50, 10.75, 11.
How do you write an RNA sequence if given the DNA sequence?
Bases A and T link together and C and G link together. If your DNA sequence was, for example, ATCGAGT your RNA sequence would be TAGCTCA.
What geometric shape has four sides no sides parellel no sides perpendicular?
A kite would fit the given description.
How do you find the 99th nth term in a geometric sequence?
The 99th term would be a times r to the 98th power ,where a is the first term and r is the common ratio of the terms.
What is a successive ratio?
In a sequence, the ratio of the third term to the second term is the one successive from the ratio of the second to the first. The successive ratios are : u2/u1, u3/u2, u4/u3 and so on. In a geometric sequence, these would all be the same.
What is the 9th term of the following geometric sequence Enter a whole number - 7 -21 63?
The sequence, -7, -21, 63 could be generated by Un = 49n2 - 161n + 105 so when n = 9 the term would be 2625.
What is A closed geometric figure mad up of three or more line segments?
A polygon would fit the given description
How would the following base sequence be coded for in mrna cag tgc acg?
Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's. Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'. However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu. I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What are the next three terms in the geometric sequence 2 6 18 54?
Each number is 3 times the previous number so they would be 162, 486, and 1,458.
